r

ribon

@preview

RNA secondary-structure visualization and analysis.

v0.1.0
GPL-2.0-only

Package Information

Last Updated
Minimum Typst Version
0.14.0
Categories
visualization

1. Get the package

Download the package using the TPIX CLI:

tpix get @preview/ribon:0.1.0

2. Import in your Typst file

Add this to your .typ file:

#import "@preview/ribon:0.1.0": *

Version History

0.1.00.14.0
e865994150bf...

Ribon

Ribon visualizes and analyzes RNA secondary structures in Typst. It accepts sequences and extended dot-bracket notation, predicts structures from sequence alone, and turns analysis results into editable diagrams and quantitative plots.

Usage

Draw a known sequence and extended dot-bracket structure:

#import "@preview/ribon:0.1.0": *

#draw(
  "CGCUUCAUAUAAUCCUAAUGACCUAU",
  structure: "((..((....)).(((....))).))",
  method: "naview",
  width: 13.6cm,
  height: 6.6cm,
  theme: varna-theme,
  numbering: none,
  show-ends: false,
)

RNA secondary structure with a highlighted loop and base pair

Or predict a structure and send the same result to drawing and probability plots:

#let sequence = "GGGAAACCCGGGAAACCC"
#let result = analyze(sequence)

#render(
  result,
  which: "mea",
  width: 9.6cm,
  height: 6.6cm,
  theme: varna-theme,
  numbering: none,
  show-ends: false,
)

Predicted RNA secondary structure

#dot-plot(
  sequence,
  probabilities: result,
  width: 10cm,
  height: 10cm,
  legend: false,
  x-label: none,
  y-label: none,
  x-axis: axis-style(label: none, show-labels: false),
  y-axis: axis-style(label: none, show-labels: false),
)

Base-pair probability dot plot

#mountain-plot(
  sequence,
  probabilities: result,
  reference-structures: (),
  width: 14.6cm,
  height: 5.4cm,
  legend: false,
  x-label: none,
  y-label: none,
  x-axis: axis-style(label: none, show-labels: false),
  y-axis: axis-style(
    label: none,
    show-labels: false,
    minor-tick-step: 0.5,
    grid: "both",
  ),
  layout: plot-layout(aspect: 2.7),
)

RNA mountain plot

The complete reference manual covers installation, data conventions, models, constraints, every analysis operation, all renderer controls, annotations, plots, errors, performance, validation, and figure-export guidance.

Drawing known structures

Ribon accepts sequence plus extended dot-bracket notation. Positions are one-based. Use & in both strings for a strand break; it does not consume a nucleotide index.

#draw(
  "GGGG&CCCC",
  structure: "((((&))))",
  method: "linear",
  width: 11.6cm,
  height: 4.1cm,
  theme: varna-theme,
  numbering: none,
  show-ends: false,
  show-direction: true,
)

Antiparallel RNA duplex drawn as two strands

Crossing pairs can use additional bracket alphabets and are rendered directly:

#draw(
  "GCGCAAAAGCGC",
  structure: "(([[..))..]]",
  method: "circular",
  width: 7.8cm,
  height: 7.2cm,
  theme: varna-theme,
  numbering: none,
  show-ends: false,
)

RNA pseudoknot with crossing interactions

Layout methods

Method Intended use
naview General secondary-structure diagrams with balanced stems and loops
simple RNAplot-like regular-bond radial diagrams
circular Crossing structures and global topology
linear Antiparallel multi-strand ladders, strand interactions, and long single-strand arc diagrams
turtle Affine loop/stem construction
puzzler Collision-reduced loop layout for crowded structures

All layouts support aspect-preserving fit, explicit width and height, rotation, reflection, clipping, long-RNA level of detail, and editable coordinates.

#let scene = data(layout(sequence, structure, method: "naview"))
#let revised = scene.points.enumerate().map(((index, point)) => {
  if index == 3 { (x: point.x - 0.15, y: point.y - 0.12) }
  else { point }
})
#scene.insert("points", revised)

#render-scene(
  scene,
  width: 13.6cm,
  height: 6.6cm,
  theme: varna-theme,
  numbering: none,
  show-ends: false,
)

RNA structure with manually edited coordinates and annotations

Prediction and analysis

analyze runs the integrated secondary-structure workflow:

  • minimum-free-energy structure and energy;
  • log-domain partition function and ensemble free energy;
  • base-pair and unpaired probabilities;
  • centroid and maximum expected accuracy structures;
  • ensemble diversity and positional entropy summaries.
#let response = analyze(
  "GGGAAACCC",
  model: analysis-model(
    temperature: 37,
    dangles: 2,
    salt: 1.021,
    mea-gamma: 1,
  ),
)

#let result = data(response)
#result.mfe_structure
#result.mfe_energy_kcal_mol
#result.centroid_structure
#result.mea_structure

Use fold when only the MFE is needed and evaluate for a supplied planar structure. The same versioned response envelope connects directly to render.

Thermodynamic models

Ribon ships the standard RNA and DNA parameter families generated from the official RNAstructure 6.6 tables. Both families support temperature interpolation and explicit dangle models; the RNA family additionally supports the published monovalent-salt correction. Model identifiers and parameter fingerprints are explicit.

#let rna = analysis-model(temperature: 25, salt: 0.15)
#let dna = dna-model(temperature: 25)
#let provenance = data(parameters())

thermodynamic-parameter-overrides and custom-model accept a named, SHA-256-fingerprinted normalized table overlay while inheriting omitted tables from a built-in family.

Constraints and probing

One constraint dictionary is shared by MFE, partition, decoding, evaluation, sampling, suboptimal, and accessibility operations.

#let constraints = folding-constraints(
  force-unpaired: (4, 5, 6),
  force-pairs: (constraint-pair(1, 9),),
  forbid-pairs: (constraint-pair(2, 8),),
  no-lonely-pairs: true,
  soft: soft-constraints(
    unpaired: (position-energy(5, -0.8),),
    pairs: (pair-energy(1, 9, -1.2),),
  ),
  probing: probing-data(
    (0.1, 0.2, 0.8, 0.9, 0.7, 0.2, 0.1, 0.1, 0.0),
    kind: "shape",
    method: "deigan",
  ),
)

#analyze("GGGAAACCC", constraints: constraints)

Ensemble and specialized analysis

The stable public API also includes:

Function Analysis
sample Reproducible stochastic backtracking
suboptimal Deterministic k-best structures in an energy band
accessibility Exact joint-unpaired probabilities and opening energies
local Sliding-window pair and accessibility probabilities
duplex Connected intermolecular duplex ensemble
cofold Unrestricted two-strand ensemble and mass-action solution
circular Circular-RNA MFE, partition, centroid, and MEA
modified Position-specific modified-nucleotide energetics
gquad Integrated secondary-structure/G-quadruplex ensemble
comparative Gap-aware alignment folding with covariation
pseudoknot Crossing-pair prediction and matching decoders
conditional-density2 Fixed-seed density-2 pseudoknot ensemble
fatgraph-topology Genus, boundaries, Euler characteristic, crossings
landscape Global minimum-saddle path over planar structures
inverse-design Exhaustive IUPAC-template target design
ligand Joint structure/ligand microstate ensemble

Sampling, conditional suboptimal structures, pseudoknot outputs, circular results, comparative results, modified-base results, G-quadruplex results, and ligand results all connect to render without an adapter.

Annotations

Ribon provides renderer-native layers for regions, bases, pair edges, secondary-structure motifs, interactions, coaxial stacks, free labels, strand names, numbering, and quantitative tracks.

Nucleotide labels automatically use the black or white text color with the highest WCAG contrast against each solid node fill. The default "aa" mode requires 4.5:1. Select strict 7:1 contrast globally with node-text-contrast: "aaa", or per nucleotide with base-annotation(text-contrast: "aaa"); an explicit text-fill always takes priority. Use contrast-on-failure: "best" only when a mid-luminance fill must be retained even though AAA is mathematically unattainable.

#draw(
  sequence,
  structure: structure,
  width: 13.6cm,
  height: 6.6cm,
  theme: varna-theme,
  numbering: none,
  show-ends: false,
  annotations: (
    highlight(4, 6, fill: rgb("#ffe082").transparentize(25%)),
    base-annotation(13, fill: rgb("#313695"), text-contrast: "aaa"),
    pair-annotation(10, 18, stroke: (paint: red, thickness: 1.2pt)),
    interaction-annotation(5, 14),
  ),
)

RNA structure with base, pair, region, and text annotations

Continuous annotations retain their scale, so draw creates the exact matching legend automatically:

#let scale = color-scale(
  minimum: 0,
  maximum: 1,
)

#draw(
  sequence,
  structure: structure,
  width: 13.6cm,
  height: 6cm,
  numbering: none,
  show-ends: false,
  annotations: value-annotations(values, scale: scale),
  legend: legend-style(stroke: none),
)

RNA structure colored by continuous values with a color legend

Specialized helpers include reactivity-annotations, accessibility-annotations, local-accessibility-annotations, entropy-annotations, topology-annotations, and coaxial-annotations.

Comparative and quantitative figures

compare-structures overlays shared, removed, and added base pairs on common coordinates. dot-plot displays one ensemble with an inferred reference structure or compares two ensembles across the diagonal. mountain-plot combines the expected profile with supplied discrete structures; mountain-profile exposes the same numerical series. Multiple decoder or collection results can be composed with Typst's native layout primitives.

Quantitative figures use four independent configuration values. plot-theme controls visual styling; axis-style controls domains, linear or logarithmic transforms, reversed axes, major and minor ticks, formatters, labels, and grids; plot-layout controls padding, aspect ratio, frame, and clipping; legend-style controls four outer positions, nine inner anchors, explicit plot coordinates, anchors, offsets, direction, columns, width, and spacing. Mountain series can be assigned to primary or x2/y2 secondary axes. Legends may be local to one plot or shared across a composed figure.

#compare-structures(
  sequence,
  reference,
  alternative,
  width: 13.6cm,
  height: 6.6cm,
  legend: false,
  numbering: none,
  show-ends: false,
)

Overlay comparing two RNA secondary structures

#let untreated = analyze(sequence)
#let treated = analyze(
  sequence,
  constraints: folding-constraints(force-unpaired: (1, 2)),
)

#dot-plot(
  sequence,
  probabilities: untreated,
  comparison: treated,
  width: 10cm,
  height: 10cm,
  threshold: 0.005,
  legend: false,
  x-label: none,
  y-label: none,
  x-axis: axis-style(label: none, show-labels: false),
  y-axis: axis-style(label: none, show-labels: false),
)

Dot plot comparing two RNA base-pair probability ensembles

#mountain-plot(
  sequence,
  probabilities: untreated,
  reference-structures: (),
  width: 14.6cm,
  height: 5.4cm,
  legend: false,
  x-label: none,
  y-label: none,
  x-axis: axis-style(
    label: none,
    show-labels: false,
  ),
  y-axis: axis-style(
    label: none,
    show-labels: false,
    minor-tick-step: 0.5,
    grid: "both",
  ),
  layout: plot-layout(aspect: 2.7),
)

Expected and reference RNA mountain profiles

#let decoder-sequence = "GCGCCUUGAAAGUCCAGAGGACUUGGUUUUAUUGGGUAGUUGAGGUUGGUGGCCCAUCUC"
#let decoder-result = analyze(decoder-sequence)

#grid(
  columns: 3,
  gutter: 4mm,
  ..("mfe", "centroid", "mea").map(which => render(
    decoder-result,
    which: which,
    width: 4.6cm,
    height: 5.4cm,
    node-radius: 2.2pt,
    font-size: 3pt,
    detail: "full",
    numbering: none,
    show-ends: false,
  )),
)

Comparison of RNA structure decoding methods

Stable protocol and errors

Every operation uses the ribon.analysis/1 response envelope. Normal code uses typed wrappers and data(response). Low-level integrations can call request; input-facing documents can call try-request and inspect ok plus error.(code, message).

#let response = try-request(
  "validate",
  (sequence: "GGG", structure: "((."),
)

#if not response.ok {
  [#response.error.code: #response.error.message]
}

Default document-time limits reject unexpectedly expensive requests with the stable resource_limit code. Explicitly bounded work can opt in:

#let exact = execution-policy(allow-expensive: true)

Ribon does not silently substitute an approximate state space.

Figure and export guidance

  • Keep the package version, parameter model, temperature, salt, dangles, constraints, and probing conversion with the archived analysis.
  • Use legends for continuous tracks and describe whether structures are predicted, comparative, or experimentally constrained.
  • Fix seeds for sampled structures.
  • Select the final page size before checking label placement.
  • Export PDF or SVG directly; the renderer produces native vectors.
  • Treat pseudoknot decoders and thermodynamic ensembles as different scientific objects.

Validation

The release suite covers both numerical output and rendered images:

  • 24 diverse Rfam families across the analysis operations and all six layouts;
  • 24 published pseudoknot records;
  • exhaustive short-input checks, mass balance, finite differences, MFE re-evaluation, sampling, and k-best ordering;
  • numerical comparisons against the official RNAstructure 6.6 CLI;
  • exact-value and pixel-golden plot contracts covering all legend anchors, shared legends, custom/logarithmic/reversed/secondary axes, and continuous scales;
  • a 72-page real-RNA vector PDF checked for blank pages, clipping, text, raster contamination, and pixel-exact hashes;
  • a rendering contract covering annotations, comparisons, plots, long-RNA detail, and all result-to-render connections.

See the repository's validation methods, model boundary, and reference index for exact methods and measured results.

Build and test

From the package directory:

just plugin
just test
just docs
just images
just check

The docs recipe builds the manual with the pinned Typst 0.14.2 toolchain through Nix. docs-current uses the Typst executable already on PATH.

License and provenance

Ribon is licensed under GPL-2.0-only. The bundled parameter tables require the same license.

See NOTICE.md and THIRD_PARTY.md for bundled-data provenance, dependency notices, hashes, and licensing details.